Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10057A2
Clone ID IST10057A2
Vector VICTR75
Project tigm

Sequence tag IST10057A2BBR1
Sequence
CTAGACATGGAGTTCAAACCTGGCCGCCGCAAAACCTTGTCTCAAAACACACAGAAGCAAGCAAGCTAGCTAGCAAGCAA
GCAAGCAAGCAAGCAAGCAGCACAACAAAACAAAACAAAGAAAAATCAAGCCGCATGTTACATAAATGTCCACTTCAAAT
AAATGGGCTATTGCAGGGAGTGCGGTAC
Sequence Type genomic DNA
Unitrap ID UNI24420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88935923..88936110 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]

 
Come back to gene ENSMUSG00000072553


For any suggestions or comments, please send an email to unitrap@crg.es