Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A054B06
Clone ID A054B06
Vector pT1betageo
Project ggtc

Sequence tag A054B06
Sequence
TGGAGTTGGAGGAAAANNNNCCTTTCTTTCCAAAAGAAACTTGAATTTTAAGGATTAGGAAGTCCCAGNNATTGGGNGNN
CNGGGGGNNNNAAGGCCANNNNNNAGTGGNNNAAAGAAAACAGGGAAGAATCCCAAGATTTCAAGAACAAAACGAGGANN
ANNNNCGCCAGTTTTAGAAGGATCATCGAAATAAAATTAATGAGGTGCTTGCAGCAGCTAAAGAGGACTTTGTAAGCAAA
AAGCTGAACTACTTCTTCAGAAGGAGACAGAATTCCAGGCATGTTTGGACCAGAGTCGCAAGGAGTGGACACTGCAGGAA
GCCCAGCAGACACAAGTGGAAATCCGTCAGTATGAGGAAGACACCCTCACTGTACTTGCCTATCTTCTAAAGGACACGCA
GCTGGAGTACGGTGGGGACTCACAGGACAAGCAGCTTTTGGAAGCCATGTCAGCTTGTTCTTCCAAATGGATATCTGTAC
AGTACTTTGAGAAAGTAAAAGCCTGCATACAAAAAGCTCTTCACGATATGCTGTCCTTGCTTACAGACAGTGTCGCCTCA
GAGCAGGAGAAGAGAAAGGTGGTCAAGAGCTCTGCAGACACTGTCAGCTGGACCAGTAGCGAAGGAGACNNNGCGGTCCC
AGTGCCCCCTCCTACTCCAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCTGAAAGCAGAAGCAGAAACT
Sequence Type mRNA
Unitrap ID UNI11762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125402451..125405680 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068394 (Cep152) NM_001081091 centrosomal protein 152 Gene [Source:MGI (curated);Acc:Cep152-001]

 
Come back to gene ENSMUSG00000068394


For any suggestions or comments, please send an email to unitrap@crg.es