Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0817
Clone ID CH0817
Vector pGT0lxr
Project sanger

Sequence tag CH0817
Sequence
GCAGAAAACAGTTGAAACCGAAGAGGGAACAGTGCAGATTCAGGAAGGCGCAGGGAATAAAAAAGAGGACCCAACTAGTG
TAGCTATCGCCAGCATCCAGTCAGCTGCCACTTTTCCTGACCCCAACGTCAAGTACGTCTTCCGAACTGAGAATGGGGGC
CAGGTGATGTACAGGGTGATCCAGGTGTCAGAGGGGCAGCTGGATGGCCAGACAGAGGGCTCTGGCGCCATCAGTGGTTA
CCCTGCCACTCAGTCTATGACCCAG
Sequence Type mRNA
Unitrap ID UNI1670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 173345639..173346367 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026641 (Usf1) NP_033506 upstream transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:99542]

 
Come back to gene ENSMUSG00000026641


For any suggestions or comments, please send an email to unitrap@crg.es