Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A053D03
Clone ID A053D03
Vector pT1betageo
Project ggtc

Sequence tag A053D03
Sequence
TGTACATTGGTGGCCAGCAGGCTTTCTTCAACTATTCTACAAGTAAAAGAATCACTCGGCCAGGAAATACCGACGATCCA
TCAGGGGGCAACAAAGTGCTCTTGCTCTCTATTCAGAATCCTCTTTACCCAATTACGGTGGATGTTCTGTATACTGTATG
CAACCCTGTTGGAAAAGTACAGCGTATTGTTATCTTCAAGAGAAATGGGATACAAGCAATGGTTGAGTTTGAGTCAGTCC
TTTGCGCCCAGAAGGCTAAAGCAGCACTCAATGGAGCTGATATATATGCCGGATGTTGCACACTAAAAATTGAATATGCA
AGGCCAACTCGTCTAAATGTTATTAGGAATGACAATGACAGTTGGGACTACACTAAACCTTATTTGGGAAGGCGAG
Sequence Type mRNA
Unitrap ID UNI11771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80447948..80450107 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024095 (AC122253.5) NP_659051 Heterogeneous nuclear ribonucleoprotein L-like [Source:UniProtKB/Swiss-Prot;Acc:Q921F4]

 
Come back to gene ENSMUSG00000024095


For any suggestions or comments, please send an email to unitrap@crg.es