Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11263A1
Clone ID IST11263A1
Vector VICTR76
Project tigm

Sequence tag IST11263A1HMF1
Sequence
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI14535 UNI31760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110662246..110662345 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074968 (Tmem16c) NP_001075025 anoctamin 3 Gene [Source:MGI (curated);Acc:Tmem16c-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47484873..47484972 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]


Sequence tag IST11263A1HMR1
Sequence
TTCAGACATATGATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGATTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006313..3006379 65
NO GENE  

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es