Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W191C01
Clone ID W191C01
Vector ROSAbetageo
Project ggtc

Sequence tag W191C01
Sequence
GNNTCAAAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGAAGAAGGAAGATGAGTTGTGGGCCAGCTTCCTTA
ATGATGTAGGACCAAAGTCAAAAGCAGCCCCAGGTTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTCGAAT
AAACCGTTGGTCAAAGCAGATGAGCTGGATAAGCCTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTGACTTCGC
TGGCGAAGAAGTAAGGGTGACTAAGGAAGTAGATGCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCANNNAGAGAAAG
AAANNNNNNAGNNNNNNTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGNNA
TCCGCCAANGNNNGAAAAANNNCATAANNNCGANNNNNGNCAAGGGAAAGCCAAAGNNNNGGCCA
Sequence Type mRNA
Unitrap ID UNI8740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354822..114365767 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es