Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12011G4
Clone ID IST12011G4
Vector VICTR76
Project tigm

Sequence tag IST12011G4HMF1
Sequence
GTGCGACTGTGCGGGGGGCGTCCCACGCGACAGGACCGCGGCCCAGGTGAGTGTGGCTAGGGCGGGGTCTCCCACAGAAG
TCCTGCCTGAGGCCAGGGACCCTGACGATTGAAGCCCGATGAGGAGGGGGGTGTCCCAGAAGTGGAAGAGGTGGGCCAGA
ACGACAGAATTTACGGGACTATCCTTCAGGTTCTTCCTCTTTGCCTGTAATGCCGAGTCTCCTTGCTTTCGAGGGCAGGG
GGAAGGTTTGAGGGGCGAAGTCTGGCGCCCCAAGCTTCTCTGCTCCTGTCAGCCCCCCTTCAGCACAGGACTCCCCACCC
CCCACGGTTCTTCGCCTACNTGCGGGTTCTCGCGATTCTTTCCATCCGAAGTGGCGGGGCTTGAGGGGTTCTGGACGCTT
GGGTNACCCCGANGGTTTCTGCNGCCCTGGCTGCCCCGCCCCCGCTCCGGCTCTCCCGCCCCTCCACGCTTTGGCTCTGT
TCTTCCTGGTCNANCN
Sequence Type genomic DNA
Unitrap ID UNI32432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69614490..69614980 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042826 (Fgf11) NM_010198 fibroblast growth factor 11 Gene [Source:MGI (curated);Acc:Fgf11-001]

 
Come back to gene ENSMUSG00000042826


For any suggestions or comments, please send an email to unitrap@crg.es