Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947H4
Clone ID IST14947H4
Vector VICTR76
Project tigm

Sequence tag IST14947H4HMR1
Sequence
ACTGCCCCTCACCTTGCTTTGCTGGCGATCACCATCAACATAGCTCCAGTTTGGAAATATAGTCNTTTTAAGATATAATT
C
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6078098..6078177 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14947H4HMF1
Sequence
CAGTGAGGTGATGAGTCAGCAGATACAGGTGCCTGCTGTGCAAAGCCAGCAGCATGAGTTCCAGCCCCACAACCCACATA
AAGGCGGAGGGAGAAAACTAACCGCACAGAGCTGTCCTCTGACCCCCACGCACGCGTGCCAAGGAACAGTTGCCCTGACC
ACCACCTGCCCAATGTACCCACAAACTAAGCACTAAGGGCAGGTGTACTCAAAGAAGTTTCCAAAGAGTGTTACACGGAG
TATTAAAATGTAAATGAGGCATCCAAAAGATGGAGACTGACTGGATGGCANAAGTCTCTCAAAAGACCTGCGCATCTGAG
GCANTGAGGACTTTGGACTTTATAANTGGTGANGAGTNAAACNCNGNANGCNNGAACTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6078174..6078553 356
 
EST/CDNA Est Name
  CD540754.1 - AA561879.1 - AI615504.1

 
Come back to gene CD540754.1 - AA561879.1 - AI615504.1


For any suggestions or comments, please send an email to unitrap@crg.es