Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11405H11
Clone ID IST11405H11
Vector VICTR76
Project tigm

Sequence tag IST11405H11HMR1
Sequence
ATGTGCAAGCTGTGCCATATAACACAGGCAAAGAACATGTCACACTGTTCATGGCACACTGTCAGAATGTTATTGAATAA
CTATAAATTGACAAGGTTTAAAGGATCCAAAGGCAGAAACTCATCATAAAATCTGCCTCCCTGAGTAGCC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858471..84858620 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST11405H11HMF1
Sequence
CACATGACCNTTTGCTTTCTCAAGACTGGGGCTCATTCTGTAGCTCAGGCTGGCCTCAAATTTGTGGCGCTAACCCCACC
TTCTCCTCCCGAGTGCCTGGGACTGATGATCACAGGCGTGAGCCACCACTCCTGGCTTTACACCAAANAGTCTTTGAAGT
CTTTGATCATATTTTTCCCTACAAGTTGAGACTTCTGTTTGTTCTTTTANAATCAAGGTTGTCTTTACATNGTTTTTTTT
TTTNAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858229..84858475 237
NO GENE  


Sequence tag IST11405H11BBF1
Sequence
CACATGACCNTTTGCTTTCTCAAGACTGGGGCTCATTCTGTAGCTCAGGCTGGCCTCAAATTTGTGGCGCTAACCCCACC
TTCTCCTCCCGAGTGCCTGGGACTGATGATCACAGGCGTGAGCCACCACTCCTGGCTTTACACCAAANAGTCTTTGAAGT
CTTTGATCATATTTTTCCCTACAAGTTGANACTTCTGTTTGTTCTTTTAGAATCAAGGTTGTCTTTACATTGTTTTTTTT
TTTNAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84858229..84858475 239
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es