Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13928F5
Clone ID IST13928F5
Vector VICTR74
Project tigm

Sequence tag IST13928F5HMF2
Sequence
CATAATTTATTTATTAACTAGAAATATGCATAAGCAATTGTAAATTTGAGAATTAATAGTATCTGAGGGATGAACAATTT
AAGCAATTGCGAGCTCANAGATATGGCATTGACTATTAATATACAAATTAAGGTTTGATTGTTCAGCATTTTAAAACACC
ATCTACAGCACACAACTANATCATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACTCCGCCCCACANAAGCTAGTTG
GGCCCACGTGGGCCAACNATCGGCTGGGAGGATGANAAAAATGACTTTACAATAATGTTTTCTTTTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469074..7469384 301
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920111..52920421 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939800..136940110 301
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776705..115777015 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  


Sequence tag IST13928F5BBF1
Sequence
CATAATTTATTTATTAACTAGAAATATGCATAANCAATTGTAAATTTGANAATTAATAGTATCTGAGGGATGAACAATTT
AANCAATTGCGAGCTCAAANATATGGCATTGACTATTAATATACAAATTAAGGTTTGATTGTTCANCATTTTAAAACACC
ATCTACAGCACACAACTANATCATCTGTGCTGGAACAGGGGAAACTGTGTCTTAANACTCCGCCCCACANAANCTANTTG
GGCCCACGTGGGCCNACNATCGGCTGGGAGGATGAAAAAANTGACTTTACAATAATGTTTTCTTTTTGGCCAAAAAANTG
TTTTGGGCACAACCAATTTTNAATTACCNNTTNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030321


For any suggestions or comments, please send an email to unitrap@crg.es