Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14531F12
Clone ID IST14531F12
Vector VICTR74
Project tigm

Sequence tag IST14531F12BBF1
Sequence
GTATAACAGGCAGTCTCCTCCCAGCTCTAGGTTCCATTTGCAGTGCATCCTGGGACGACAGAGGGCCCATGTGACCCTCA
CTCAGGTAAGACCACAAGTTGGAAGCCTTGCCATCGTCCATGTGACTTTAGTGAGGTTGAAAAAGTGGTACACTGACCTT
CAGCCAGACTTGACAGTCTTGGAGACAGAAAAATGCCGATCAATCAGAACTCTTTTTATGCCCATGGCCACCCTCAGGAC
TTCAGCCTTTTCCTGTGTCATGATGACCCTGAGTACTGTCACCAACTCCTGGTGATTGACAGAACCAACCTAAGCTGCAT
CTTCTCATCTGTTGTCCCATGGCACTTGTGACAGCCAGGGAAGGGGACAGCCTTGTTTGCTTTGATACAGGATATTANGA
ATAAAAGCAAGCTAGGGGCCTTGTGGCACATGCTTTTAATCCCAGAACTCAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920609..30921062 452
 
EST/CDNA Est Name
  CF532568.1 - CV559602.1 - CK636270.1 - CF535965.1 - CO431220.1 - DT919270.1 - CB523244.1 - CF744396.1 - BY090554.1 - BB636496.1 - BU052765.1


Sequence tag IST14531F12HMR1
Sequence
ATACTATCCNCCGTGGTCCAAAGCTTTCCCTCGTTATCCTGTGTGTGTGTGTGTGTGTGTGTGTGTNTGTNTNTN
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920543..30920612 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST14531F12HMF1
Sequence
GTATAACAGGCAGTCTCCTCCCAGCTCTAGGTTCCATTTGCAGTGCATCCTGGGACGACAGAGGGCCCATGTGACCCTCA
CTCAGGTAAGACCACAAGTTGGAAGCCTTGCCATCGTCCATGTGACTTTAGTGAGGTTGAAAAAGTGGTACACTGACCTT
CAGCCAGACTTGACAGTCTTGGAGACAGAAAAATGCCGATCAATCAGAACTCTTTTTATGCCCATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30920609..30920838 230
NO GENE  

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es