Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A026E05
Clone ID A026E05
Vector pT1betageo
Project ggtc

Sequence tag A026E05
Sequence
TTTTTTTTGNNGTTANNNGNNNNNNNNNNNANGGCCNNNNGANNNNNNNNNNNANNNNNANNNNNNNNNNNCCNNNCCCN
NNNNNNGNNNNNNAAGNNNNNNNNNNNNCNNNNNNNNAAANNNNNNNNNGGNNNNNNNNGGGNNNNNNNTNNTNNNNNAN
NNNNANNNNNNNNNNNNCNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAAAANGNNCNAGAGCTACCCCCAAAAG
GAANNNAACGGGCCCCCCAAGGAGGGTTAAAGCGCCAGTTCCAGAAAGCTAAGTGTTAAAAGNAANNNNNNCTGANNNNN
NNNNANNNNCCNNNGGGTGTTTTATCNNCGCTGGTACCTNNNGAAGCACATGAACGTTACTCACAGGCGCATGCAGATCT
GTGATAAATGTNNCNNNAAGTTTGTCCTNNNAAGTAAGCTGTCCCTTCACCAGCAAACAGACTGTGNAAAAAACATTCAG
TGTGTTTCCTGTAACAAATCCTTCAAGAAACTCTGGTCCCTTCATGAACATATCAAGATTGTCCATGGATATGCAGAAAA
AAAATTTGCCTGTGAAATTTGCGAGAAGAAGTTCTATACCATGGCTCATGTACGAAAACACATGGTTGCACACACAAAAG
ACATGCCATTTACATGTGAGACCTGTGGAAAGTCTTTCAAGCGCAGTATGTCACTCAAGGTGCACTNNNNNNNNNNNNNG
GAGAGAAACCCTTCAGATGTGAGAACTGCGATGAGAGGTTCCAGTACAAGTACCAGCTCCGCTCCCACATGAGCATCCGC
ATTGGGCACAAACAGTTCATGTGCCAGTGGTCTGGGAACATGTTCATCACCACAGTTAACANNNNNNNNNNNNNNNNNNG
GAACAAGG
Sequence Type mRNA
Unitrap ID UNI11784

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95611201..95615330 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075595 (Zfp652) NM_201609 zinc finger protein 652 Gene [Source:MGI (curated);Acc:Zfp652-001]

 
Come back to gene ENSMUSG00000075595


For any suggestions or comments, please send an email to unitrap@crg.es