Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M080E01
Clone ID M080E01
Vector U3CEO
Project ggtc

Sequence tag M080E01
Sequence
TCTTCCTCACTCTGAGCACCCCACCTGCCGCCGCCCTGGACCTGCAGGAGGTGGAGAGCAAGATAGATGGCTTCAAATGC
TTCGCCAAGAAGATGGACGACAGTGCGTTGCAGCTCAACCACACCGCCAACGAGTTTGCGCGCAAGCAGGTGACTGGCTT
CAAGAAGGAGTATCAGAAGGTGGGCCAGTCCTTCCGGGGTCTCAGCCAAGCCTTTGAGCTGGATCAGCAGGCCTTCTCCG
TGGGTCTGAATCAGGCCATTGCCTTCNNNNNNNNNNNNNNNNNNNNTTTTATTT
Sequence Type mRNA
Unitrap ID UNI11791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114407146..114407411 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042364 (Snx18) NM_130796 sorting nexin 18 Gene [Source:MGI Symbol;Acc:MGI:2137642]

 
Come back to gene ENSMUSG00000042364


For any suggestions or comments, please send an email to unitrap@crg.es