Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14187C1
Clone ID IST14187C1
Vector VICTR74
Project tigm

Sequence tag IST14187C1HMR1
Sequence
CCGAAAGCCTAAGGGAGCCGTTGTTTCCGTCCNCGGAACGCGAGCCGGGTGGCTGTGCCTACTGGGGGCTGCGTTGCAGT
TCTCGGCATAACTGAGCACAAGTTTGTCTCCCCGACAGACGTTCGGTGAACTTGCTGTGGTGGACTGGAAAGACACTAGG
AGCCAGAGCAGCCGAGAGAGTAGCAGGAGAGGGTACCTGACCCCAAAGAGGCTANAAAATATGTAAGCTGAATTAGGGAC
GCGAGCAAAAAGGTATGAGGGTGGAGTTTANGAACNGTTTGGAGAGGANAGGGTGTTGGGTTGTATAGAAAACGAAGAGG
TTGGCTTTGTTGAAATATTNNNGCGTTGTNNNNNNNNNNNCNTGCTTTTTTTTNNNCNNNCCNNANNAN
Sequence Type genomic DNA
Unitrap ID UNI32440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87551285..87551633 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020485 (Supt4h1) NM_009296 suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Supt4h1-001]


Sequence tag IST14187C1HMF1
Sequence
TCGGGCTTCCCACTCCCCGAATCTCAGAGCCTTCCTTTCCTGTGTCTGGCCCCATTTCACCCTCTTTCTCCCGTTTCGCC
TCCCCGATCGCTCCTACAACCAAGGCCCCAACGGACACCTTGACTAACGAGCACAGCAAACAAGCCCGCAGATGCCGCAG
GTCCTTTGGTACCGTCTCCAGGGCCATCCTCACCGATACGACAACACAGGTTCCTCCAGCCGCAGGAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87551060..87551288 229
NO GENE  

 
Come back to gene ENSMUSG00000020485


For any suggestions or comments, please send an email to unitrap@crg.es