Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631D9
Clone ID IST14631D9
Vector VICTR74
Project tigm

Sequence tag IST14631D9HMR1
Sequence
NNNNNGGTCTCCCCTACTGTGTTCTGAGAACCCTGGTGCACTGTTGAGACTCCTAATGAAGGCGTGTGTAACGTTAGATA
CATTCTCTCCAGGATGGACTTCCCTGGCACCCTGCGCCCTTCATTGTTTAAGGCCGGTCCACTTGGCATGACTGATGGCC
CTGACCTGTCCTTCATGTGCAGCTGGAGAGATGCACTGACCCTGCCAGGGTCCNAGCCACAGAACTGCAANGTGAGGATG
GAAATAGGGTCCTTTCCTTGGTCTGTTCCTCCTNNNNNNNCACTTATTGGGAAAAGC
Sequence Type genomic DNA
Unitrap ID UNI32442

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122128075..122128365 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031832 (Taf1c) NM_021441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C Gene [Source:MGI (curated);Acc:Taf1c-001]


Sequence tag IST14631D9HMF2
Sequence
CTACAAGGTAGCAGATAAAGACNAGACTATGCCTAATGCCAGCGCGTCAGCAGGGCTGCCCAAGGACTGCTCACTCTCTT
GANGGCAGCCAGACAGATATCTCTGCTCACACCTTGGAAGANGGGCTGGGGAGAAAGTGATCGCAAAAGGCCTCGTGGCA
GGTAAAGTGCCAAAGAGATAAGCAACCACAGAATATACAAAGGGGAGAGTGTGGAGGACCAAGTGATGCCGATGANNCTG
AGCGTTCATCANCGCGCTGCGCATGACAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122128367..122128637 255
 
EST/CDNA Est Name
  CJ056818.1 - BY225977.1 - BY018391.1 - BY011531.1 - BY224928.1 - BY183598.1 - BY025164.1 - BY307173.1 - BY019789.1 - BY036166.1 - BY020655.1 - BY020686.1 - BY232557.1 - BY207250.1 - BY317028.1 - BY185652.1 - BY210644.1 - BY084752.1 - BY079130.1 - BY196524


Sequence tag IST14631D9BBF1
Sequence
TTACAAGAATAAGTGCAGTAAAAATATCANACCTTACAGGAGTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 94659715..94659764 48
NO GENE  

 
Come back to gene CJ056818.1 - BY225977.1 - BY018391.1 - BY011531.1 - BY224928.1 - BY183598.1 - BY025164.1 - BY307173.1 - BY019789.1 - BY036166.1 - BY020655.1 - BY020686.1 - BY232557.1 - BY207250.1 - BY317028.1 - BY185652.1 - BY210644.1 - BY084752.1 - BY079130.1 - BY196524


For any suggestions or comments, please send an email to unitrap@crg.es