Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14439G2
Clone ID IST14439G2
Vector VICTR74
Project tigm

Sequence tag IST14439G2HMR1
Sequence
NATAATTTNNNNATTATATATAACACTCTTAGAAATGAGAGGGCACATCCTCATCTTTAATTGAGCCNGATGTCTAGTTA
TTGTCTATGTGCAAATATCTCTAAGTTCATTAAAAATCTTAGTGAACTCGAGTCTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91723274..91723401 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]


Sequence tag IST14439G2HMF1
Sequence
ATATGACTCGATATAAACTTTGCTAAATCAAAAAAACACTACATAATTTATTTATTTGTGGTGCCGGGGCTTGAACCCAG
GGCCTCATCCATGCTATGTAAGTGTGGCACTACTGAGCACATCCCTAATACAACAGTTAAAACTTTCTATGTGCTCTTGT
TTTGGTAATAGAGTCCCCCTGTGTTGCCCAGGCTAAACTTGAACTGGAGCCTTAGCTGGCCTGAAACTCCTGATCTACCA
CATCCAGCTTATAAAACTTTTCAATGACATCAAATATGTTTAGAAAGGTAGGGTGGCGGGGCTGGANANATGGTTTANTG
GTTAANCANNNNGNCTGCTCTTGCANAGGACCNGGGTTCANTGCNNNNNANNNNNNCTCAGGCTCACANNTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14439G2BBF1
Sequence
ATATGACTCGATATAAACTTTGCTAAATCAAAAAAACACTACATAATTTATTTATTTGTGGTGCCGGGGCTTGAACCCAG
GGCCTCATCCATGCTATGTAANNNNGGCACTACTGAGCACATCCCTAATACAACAGTTAAAACTTTCTATGTGCTCTTGT
TTTGGTAATAGAGTCCCCCTGTGTTGCCCAGGCTAAACTTGAACTGGAGCCTTAGCTGGCCTGAAACTCCTGATCTACCA
CATCCAGCTTATAAAACTTTTCAATGACATCAAATATGTTTAGAAAGGTAGGGTGGCGGGGCTGGAGAGATGGTTTAGTG
GTTAAGCACTCTGGCTGCTCTTGCAGNGGACCTGGGTTCAGTGCCCAGCATCCACACTCAGGCTCACAACTGTCTGTGAC
ACAGTTGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91723412..91723820 399
 
EST/CDNA Est Name
  CK333682.1 - CF983082.1 - BE915802.1 - BU504177.1 - CX730009.1 - CK627198.1 - BF143001.1 - DV039928.1 - CB235287.1 - CD770512.1 - W83330.1 - BU560003.1 - BU698384.1 - BU694523.1 - BU699926.1 - BU697226.1 - BG087058.2 - BG086261.2 - CF161032.1 - CF156396.1

 
Come back to gene CK333682.1 - CF983082.1 - BE915802.1 - BU504177.1 - CX730009.1 - CK627198.1 - BF143001.1 - DV039928.1 - CB235287.1 - CD770512.1 - W83330.1 - BU560003.1 - BU698384.1 - BU694523.1 - BU699926.1 - BU697226.1 - BG087058.2 - BG086261.2 - CF161032.1 - CF156396.1


For any suggestions or comments, please send an email to unitrap@crg.es