Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14697A2
Clone ID IST14697A2
Vector VICTR76
Project tigm

Sequence tag IST14697A2HMR1
Sequence
TTACGTGTTTCTATTCTCCAATATTTCCCCCAAATTAAGAATTTCATTCCTATTTTTAAAGAGATTTCACATCTGTCTGT
TTAGAGAAACATCTCCTGTAGCTCCTACTTTCTTTCTGTCATGTAGTTAAAACTTGCTTTGAACTCCTCTTCCAGGCTCT
GCTGCCCAGGGCTTGGAAAACAGTCCTACAACTGCTTTCAGGCTGGGTTCTGACTGATCAGTGAGACAAAAGACACCAGG
GAATGAGTGTTGTCTAACCTCCCTGGGTTACAGGGTTACAAATTAGGGGATTACAAATAANGAGGAACAGGTATAAGGTT
GAGGTCNCTGACCNACTTTGAANCTGGTCNACTTGCANCACANANNANGAGGAGGAATGAGGTANGTGANNNCTTN
Sequence Type genomic DNA
Unitrap ID UNI3415

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177499946..177500334 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078864 (OTTMUSG00000016321) predicted gene, OTTMUSG00000016321 Gene [Source:MGI Symbol;Acc:MGI:3652185]

 
Come back to gene ENSMUSG00000078864


For any suggestions or comments, please send an email to unitrap@crg.es