Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10253A7
Clone ID IST10253A7
Vector VICTR76
Project tigm

Sequence tag IST10253A7HMF1
Sequence
NTGGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAA
GTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI32446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3509659..3509783 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 71563720..71563844 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036330 (Slc18a1) NM_153054 solute carrier family 18 (vesicular monoamine), member 1 Gene [Source:MGI Symbol;Acc:MGI:106684]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 123338049..123338173 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 57254296..57254420 125
NO GENE  


Sequence tag IST10253A7BBF1
Sequence
TTGGCACACGCCTTTAATCCCAGCACTTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036330


For any suggestions or comments, please send an email to unitrap@crg.es