Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10574H10
Clone ID IST10574H10
Vector VICTR76
Project tigm

Sequence tag IST10574H10BBF1
Sequence
CTTTCACTCTGAGTAAGCCTNCNTGTGGGTGAGACACAGTGAGTAAGATGGCAGGGTGTGGTGGCTCACGCCTTTAATCC
TANCACAGGCAGGTAGTTCATCTCTTGAGCTCCAGGTCAGCTCTGTGTACAAGAGCAAGTTCCANGCTANCCAANGCTAC
ACTCAAATAGCAAAGGGGAAGGCATGGATCT
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114305818..114306007 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


Sequence tag IST10574H10HMF2
Sequence
GACCCAAACTCAACAGTAAAATGATTAGAAGATAACAGCATTAAAAAAAATAACAATCAGGGAAGACTGTTCGGATGCTG
TTGGTTCTGGCACGTGGGTCTCAGGTTTCTGGGCCTATATGATCACAAACCCAGAAAAGGCCTGTTAGCTGGAGTTAGGC
TATGCCACACTTATGCAGATAGCAAGAGACAGACAAACAGTCAGGGAACTTGGACGCAAGGAAAACTTGAGGTAAAATGA
CCCTAGCCTGGACCGCTGGAAGCGCCTAGCCTCACCCTNTCCAACTGGGGTTAGCCACCAAGGGAAAGGCTCGGCTCTAT
CATCANACCCACCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156664820..156665155 332
 
EST/CDNA Est Name
  BY065444.1 - CJ081778.1 - CJ077303.1 - BY065690.1 - BY014954.1 - BY069185.1 - CJ076173.1 - CJ072434.1 - BY005134.1

 
Come back to gene BY065444.1 - CJ081778.1 - CJ077303.1 - BY065690.1 - BY014954.1 - BY069185.1 - CJ076173.1 - CJ072434.1 - BY005134.1


For any suggestions or comments, please send an email to unitrap@crg.es