Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10901H1
Clone ID IST10901H1
Vector VICTR76
Project tigm

Sequence tag IST10901H1HMR1
Sequence
CTGGTATTGTGATTAGAAAGGTGTATCACCACACTGACTTAATGTTTGTTTATGGTTAAAAATTACGGTGGATACTTCTG
TTGGTAAAACTGGCTTTCCACAACCTTAAAAATGGGTATTTGCTGTTTTTCTTTCATTCCTTAACAAACAAATCCCGACC
CTTGCCTTTAGAGACAGGCAGGAGTTTGACTTGCGCTTTGCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32449

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113686795..113686999 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041219 (Arhgap11a) NM_181416 Rho GTPase activating protein 11A Gene [Source:MGI (curated);Acc:Arhgap11a-001]


Sequence tag IST10901H1BBF1
Sequence
CCAGAGAGGGGGAAATTGGAGGATCAAGAGCTTTAGCCAGCATCANTTAGTGAGTTCAAGGCCAGCCTGAATACATAATA
CAAAATTATGGAAACTTTTTGTCTTCAAATACTACAAAGTGCTANTAATAAATTACTCACATACCTTTGTTTTGTTTTGT
TTGAGACAGGATTTCTCTGTATAGCCTTGGCCTGGTACTCACTCCCTANACCAGGCTGGCTTTTGCCCTCCCAAGTGCTG
GGATTAAAGGANTGTGCTACCACCCAGCTCCTACTTACTTTAAAATGACTTATTCANTTTTTCACANAGTCTTANAGATA
AGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113686996..113687321 312
 
EST/CDNA Est Name
  BY186372.1

 
Come back to gene BY186372.1


For any suggestions or comments, please send an email to unitrap@crg.es