Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14545D3
Clone ID IST14545D3
Vector VICTR74
Project tigm

Sequence tag IST14545D3BBF1
Sequence
ATGTNNNNGGAAGACAATAANNNNAACCTTGTCCTGACTCAGAGGCAAACAAANNCNNTGAGAANNANNCATGCTAANAN
NNNAACCCTCAACTATTAAAAGCATGAAGAAACTGCAGGAAACTGNGNCNCTTGATAGCAAGGTTGGGAGGGGAGTGGGG
AGAAAGGTAAGGGAGTATTTCATGCTTCTAGTGTCAACTGGGACCCCTGGCCCAAGGGACAGCCACATGAAGACAGGTAC
TGTTGACACCTTGCAACCCTCTTTACATGGGAAACTCGTGTAACCAGGTCTCCTAAACTGCCCACCCCCAGCTTAGGTTT
GATGGGCACGTGGGAGCCACTAAGAGTGACTGAGCAATAACATAGACCCGGTGAAGGAAGGAGATGTCCGTGTTGTCTAG
CAGTTGACAGTGACAGANNNATANAATTTGGATNANCCNTCNGACANANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14545D3HMF1
Sequence
ATGTNNNNGGAAGACAATAAANNNAACCTNGNCCTGACTCANAGGCAAACAAANACNATGAGAANAAANCATGCTAATAN
ANAAACCCTCAACTATTAAAAGCATGAAGAAACNGCNGGAAACNGNGACNCNNGATAGCANGGNNGGGAGGGGAGNGGGG
AGAAAGGTAAGGGAGTATTTCATGCTTCTAGTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14545D3HMR1
Sequence
NNTATNNGGTATACTGACTTAAAGACTTGCTTAATCTGTGGACTGAAAATTTGTAGCTGAGGCTCACTTTCTGTTACCGT
GTAGTAGGCCCTCAGGTTACTGTGTAGCTGAGGCCAGCTATGTCTATGTGCTCCTAATAATCTTCCCAAAGGCACCTTCT
TAATGCTGGGTCC
Sequence Type genomic DNA
Unitrap ID UNI32452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21138220..21138389 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es