Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14435E11
Clone ID IST14435E11
Vector VICTR74
Project tigm

Sequence tag IST14435E11BBF1
Sequence
TTCAGTATCCCCAAAACTGTCATTAACGCGCTGAAATTTTGCACGGAAGTGCAAAGCAGGAAATAAATCCTGGGGGACAA
TAATAATGTTACACTCGAGCAAGTCTCTTTGAAAGCTTGGGAGGACGGTGGTCTCAATACATCAGCAGTAAAGCAGGCAG
CGGACTGATGCATTTAAAAGTATGGCTTTTCCCGAGCCAAAGCCGCGGGCACCGGAGCTGCCGCAGAAACGGATGAAGAC
GCTGGACTGCAGCCAGGGCGCGGTGCGAGCCGTGCGATTTAATGGTAAGCGCCTTCNCCTTCCTCNNNNNCGTCCCTCCN
CNCGAGACCGGCGGTCCCNTAACCNNNGCNNNTTGTTCCNCANTGGACGGNNNCTACTGCCTGACNTGCGGCNNCGANAA
AACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14435E11HMF1
Sequence
TTCAGTATCCCCAAAACTGTCATTAACGCGCTGAAATTTTGCACGGAAGTGCAAAGCAGGAAATAAATCCTGGGGGACAA
TAATAATGTTACACTCGAGCAAGTCTCTTTGAAAGCTTGGGAGGACGGTGGTCTCAATACATCAGCAGTAAAGCAGGCAG
CGGACTGATGCATTTAAAAGTATGGCTTTTCCCGAGCCAAAGCCGCGGGCACCGGANCTGCCGCAGAAACGGATGAAGAC
GCTGGACTGCANCCAGGGCGCGGTGCNAGCCGTGCGATTTAATGGTANNCGCCTTCGCCTTCCTCN
Sequence Type genomic DNA
Unitrap ID UNI32454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87604391..87604695 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005150 (1500041N16Rik) NM_026399 RIKEN cDNA 1500041N16 gene Gene [Source:MGI Symbol;Acc:MGI:1915086]

 
Come back to gene ENSMUSG00000005150


For any suggestions or comments, please send an email to unitrap@crg.es