Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W181A02
Clone ID W181A02
Vector ROSAbetageo
Project ggtc

Sequence tag W181A02
Sequence
ATNNNNNNNNNNANNNNNNNTACTTCCNNCNNNNNNNNNNCNNNNNTANNNCNNNNNNNNNNNNNNNNNNNACANNNNNC
NNNNNAACNNNNNNNNNNANNNNNNNNNCCTNNANNNNNNANNNNNNNNNAAACCTNNNAANNNCCANCNCNNNNNCNAA
AATCCNAANNNCNNCNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACNNANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCCCCCCTTT
TAATAANNNNNNNNNNNNNNNNCCGTGGATGAGTACAAACATTTCTACTACGCAGCGGTGCCTTCTGCACGAAACGTGCC
CTATGGGAATATTCAGAGCAGGCTGGAGCTCAGGAAAAAGCTGGGCTGCAAGCCCTTCAAGTGGTACCTGGACAACGTCT
ACCCGGAGCTGAGGGTTCCAGACCACCAGGACATAGCTTCGGGGCCTTACAGCANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTNNCCACAG
Sequence Type mRNA
Unitrap ID UNI11805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126860503..126862384 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031977 (Galnt2) NM_139272 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:894694]

 
Come back to gene ENSMUSG00000031977


For any suggestions or comments, please send an email to unitrap@crg.es