Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890A7
Clone ID IST10890A7
Vector VICTR76
Project tigm

Sequence tag IST10890A7HMF1
Sequence
GTTTTACAGTTGCTCCATGGGGTATNTGAAGAGAAGCTAGACCATGGGCAAAATTGGGCTGCAAACAAGGCAAGAATTTT
ACTAAGGATATGTANATCACGTAATGCAGGTTCTAATCCTCATTAAGAACTGGTATGGTAGGGGCTGGTGANATGGCTCA
GTGGGTAAGANCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCG
TAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGANNACAGCTACTGTGTACTTACATATAATAATAAATAAATCAAAAA
AGAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107764465..107764798 320
NO GENE  


Sequence tag IST10890A7HMR1
Sequence
ACGAATGTACATCTATAGTGGGAACAGCCTCCAGGATACCAAGTGAGTGCGAGGAACATGAGCTTTGTACTAGGCCCATG
GCCTTTCTGAAACAGGGGCCCATGCCTTGTTCATTCTGTGCCTTCTCCAGGGCTCCTGTGATGCCCTTGAGCTGC
Sequence Type genomic DNA
Unitrap ID UNI32458

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107764797..107764950 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


Sequence tag IST10890A7BBF1
Sequence
GTTTTACAGTTGCTCCATGGGGTATCTGAAGAGAAGCTAGACCATGGGCAAAATTGGGCTGCAAACAAGGCAAGAATTTT
ACTAAGGATATGTAGATCACGTAATGCAGGTTCTAATCCTCATTAAGAACTGGTATGGTAGGGGCTGGTGAGATGGCTCA
GTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCG
TAACAAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107764547..107764798 250
NO GENE  

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es