Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14620E3
Clone ID IST14620E3
Vector VICTR74
Project tigm

Sequence tag IST14620E3HMR1
Sequence
GAGGGGTGCAGGGTCCCCCGACAGAATCTGCTGCTAGCTGCACCTTTGACCTTTGACCCCAAGTACACTCAATTCCTACT
ATCCTGGGATCTTGTGGGCACTGGGGAAAGTCCTGGAGCTTTCTATTTTCTAGACTGTGCACTAAGGACATTTTTGAAGC
TTCCTCATTCCTGTCGATTCTCCCAACAACCTTGGTATATTGACTTTATAGAGAAGGAAACAGACTCAGGCAAAGCCACT
TGTANAATCACATGGTGATTGTTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4967711..4967978 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]


Sequence tag IST14620E3HMF1
Sequence
CCCTCTTTTTATTATTTTATTGTTTGGTTGGTTTAAAGTTTTGTGTGTGGTGTTGGCTATCCTAATCAGGGCCTCACACA
TACTGGGCCTGAGCTACACCCCCAAAACTTGCACCCCCTTTTAATATGCACATAGCATGAGGTCCACACAGAAGCAACTT
GTCCAGGATCATATGGTTCGCACGATGAGGAAGCCTGGACAAGAAGCTGAGTTTCTGAAACATACCTATGAAGTGACAGA
GTGGCTCTTCGACCCTCTCCCACCCACAAGTCCGGTACGACGCGTGCCTGTCAGGCGCGAGTGGCCCAGCCCGCAAGCGG
GGCGGGCCCTCAGGGTACGGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4967371..4967715 345
 
EST/CDNA Est Name
  CK617014.1

 
Come back to gene CK617014.1


For any suggestions or comments, please send an email to unitrap@crg.es