Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14165G4
Clone ID IST14165G4
Vector VICTR74
Project tigm

Sequence tag IST14165G4HMF2
Sequence
ATATATGCAAGCATACAGAGAAGAAAATAATGCACTGTGTGAAAGAAGACAGACAGGAAGCCATTTATTGAATGTTCTAT
TTATATGAAGTATCAACAATCATCAAAATCTGTACAGGCCAAAAACAAAAAACAAAAAAACACAAAACAAAAAACAAACC
AAAACCAAACCAAACGAAAAGCCCTAAAAACAACTANCAAAACTCAGGGATAAGGAATGGGTGCTCGGTTTCTTTTTGAA
ATGCTAAAATGCTCTAAAACCTGACCTAGGTGATGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI31609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 36136069..36136350 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030494 (Rhpn2) NM_027897 rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI (curated);Acc:Rhpn2-001]


Sequence tag IST14165G4BBF1
Sequence
GGTTTAGAAGGGATTAAGTTTGCCTGGAAAGTAGCGCCACTGAGGTAGGCTTGAGGATACTGTCCGAGCTGCACTTTATA
TATTCATCCTCTGCTGTGGTTTAAACGTGTCCCCAAAGTCTGTGTGTTAGAAACTTATGCCCCAGACTCACATTAGTGTA
AGGATGTGTGTGGTCTTTGGGAGGTCACTGGGACTCCATGTGGCCATGAGTGTGGTCAGGACTTCGTGGTGGCATTAGTA
GCTTTGTTAGAAGAGGAAGAGAGGACCAAGTGTGGTGGTGGCACATGCCTTGAATCCCANCACTTGGAAGGCAGAGGCAG
GCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137444621..137444948 326
NO GENE  

 
Come back to gene ENSMUSG00000030494


For any suggestions or comments, please send an email to unitrap@crg.es