Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10800D8
Clone ID IST10800D8
Vector VICTR76
Project tigm

Sequence tag IST10800D8BBF1
Sequence
TTACCGTTGTTTGTTTTGTGGTTGTTATTTGGTTTTTCGAGACTGGGTTTCACTGGCTCTCCTGGAACTTGTTCCATAGA
TTAAGCTGGCCTAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI11427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48311183..48311281 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]


Sequence tag IST10800D8HMF1
Sequence
TTACCGTTGTTTGTTTTGTGGTTGTTATTTGGTTTTTCNAGACTGGGTTTCACTGGCTCTCCTGGAACTTGTTCCATAGA
TTAAGCTGGCCTANATCTGCCTGCCTCTGCCTCCTAAGTGCTGGGATTGAAGGCCTTTGTCATTANTCCCCACCCCTAAC
CCCCAGCTCAGTGTTTTTTATGGTAACAGAAGTGGATTTGTGTCTGGGGAACTTTGATAANGCGCTATACAAATGGAAAA
ANAAATCCTTATTTCTAGTTTGGAAGTATTGGTGTTNNNATTTCCATANGAGAAGGAAGGGGAGGGGACCNAATCTTCAN
GAACTTCCTCCAGGANGTGTCACTCTCTANTTGATGCCTTGCTTTTCTGAGCGTTTAGAAAGCCCTTCCNCAGTGGTTTG
GTAGTTCCCAGCCGCCTGCTTCCTGANGTTATCTTCTTTATTTNAACACTAAGACTCTGATGGTAAATGAATTCNNCAGN
NNCCCCTCACTGCTTCTCTTTGCANAACCNATCTGANNAAAACTTGGNTGANNAAAGTGTGATTTNANCGCTGGTCCCNN
TNNNGNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es