Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10830G5
Clone ID IST10830G5
Vector VICTR76
Project tigm

Sequence tag IST10830G5BBF1
Sequence
ATTTGAGATGAAAGTCTCCCTGTTGTCCAGACTGACTTGAGCAATCCTCCTGCCTTAGCTTCTGAAGTAGCTGAGACTAC
AAGTATATGCTACCATGCTGGGCTCCAAATTGTGATTTTTTATATATATAAAATTTTTTAAAGAAACATTTATATTTATT
ACTTATTTATTTGTTACTTAGTAAGTTTTTTGAGACAGGATCTCTCACTTATGTAACTCTGGCTGTCCTGGGACTGGATC
T
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79448931..79449170 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]


Sequence tag IST10830G5HMF1
Sequence
ATTTGAGATGAAAGTCTCCCTGTTGTCCAGACTGACTTGAGCAATCCTCCTGCCTTANCTTCTGAAGTAGCTGAGACTAC
AAGTATATGCTACCATGCTGGGCTCCAAATTGTGATTTTTTATATATATAAAATTTTTTAAAGAAACATTTATATTTATT
ACTTATTTATTTGTTACTTANTAAGTTTTTTGAGACAGGATCTCTCACTTATGTAACTCTGGCTGTCCTGGGACTGGATC
CAGGCTGCCTTGAACTCACGGAGATCCAATGTAAGTTTCTCTGAAGCATTGGGATTAAAGAGTCACACCACTNTGCCCAG
CCAATTTATTTCTTTTTATTTCACGTGTCTGANTGTTTTGCCTGCATGTCTGTGCACCACATGTGTGTAGTACCCATGGA
GGCCNGAAGANGGCATTTGATTCCCCGGANTTGTAATCTCNNACNATTGTGAGCTGNCNTGTANGTGCTGNGGAANNAAN
CCCNNNTCCTAANGAAGANCAGCNNGTGCTCTTAATCNCTGNANCCNANTCTCCACCCACTCACCCNNANNTGTAAAATN
NAACNTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es