Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11074G8
Clone ID IST11074G8
Vector VICTR76
Project tigm

Sequence tag IST11074G8HMF1
Sequence
ACAGGGAAGTCAGGAGATTTAGGCTGTTGGTATAAAAATATCAAAAGCTGTTTTTCAAGAAAAGTTTCTCTCAAAAAGAG
ACTTGAGCAGTCAACG

Sequence Type genomic DNA
Unitrap ID UNI32464

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20774208..20774302 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019986 (Ahi1) NM_026203 Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

 
Come back to gene ENSMUSG00000019986


For any suggestions or comments, please send an email to unitrap@crg.es