Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13224G5
Clone ID IST13224G5
Vector VICTR74
Project tigm

Sequence tag IST13224G5BBF1
Sequence
CTGGACTTGCTGGTGAACGGTGTGCTGGCCCTGCGCTGCCTGGAAGAATTCTCAGCCNCAGCAGCAAGCTCTCCTGGGCC
CCAGCTCCGTTTGTGCCAGGTGTCTGGGCTGTTGCCNCTGCGGCCAGGGTCTTCCCTTCGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69500414..69500557 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST13224G5HMR1
Sequence
AAATNAAATTTAAAAATTAAAAAAATTAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es