Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12300E1
Clone ID IST12300E1
Vector VICTR76
Project tigm

Sequence tag IST12300E1BBF1
Sequence
ATCTGATGCCCTCTTCTGGANCGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATC
Sequence Type genomic DNA
Unitrap ID UNI32467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6076461..6076529 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015659 (Serac1) NM_177311 serine active site containing 1 Gene [Source:MGI (curated);Acc:Serac1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 99036958..99037026 67
NO GENE  


Sequence tag IST12300E1HMF1
Sequence
ATCTGATGCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18203..18275 73
NO GENE  

 
Come back to gene ENSMUSG00000015659


For any suggestions or comments, please send an email to unitrap@crg.es