Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14120E9
Clone ID IST14120E9
Vector VICTR74
Project tigm

Sequence tag IST14120E9BBF1
Sequence
CCAGAAGGTAAGGGTCAGGAGAACCGAGGAGTAGGGCGGACTANAGTGACACTTAAGTCTTCAGCCCTCTTGGTGATCCT
TCCTAGGTGCAGACAATTCGGCAGACTATGGCCN
Sequence Type genomic DNA
Unitrap ID UNI32468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985873..134985985 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030805 (Stx4a) NM_009294 syntaxin 4A (placental) Gene [Source:MGI (curated);Acc:Stx4a-001]


Sequence tag IST14120E9HMR1
Sequence
GTTATCCCCCTGCCAGGGCCGGAGTCATTGGCGACAGTTGCTCGCTGCGGTTCTCGCCCCGCAGGANCCNTGGGCTTCCG
GGATTTTCCTTCCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985689..134985786 94
NO GENE  

 
Come back to gene ENSMUSG00000030805


For any suggestions or comments, please send an email to unitrap@crg.es