Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F042F05
Clone ID F042F05
Vector pT1ATGbetageo
Project ggtc

Sequence tag F042F05
Sequence
GATATATGCAAGCTCGAAGGATGCCATCAAGAAGAAATTTCCAGGTATAAAACATGAGTATCAAGCAAATGAGCCAGAAG
ACCTCAGTCGGANNTGTATTGCTGAAAAGNNAG
Sequence Type mRNA
Unitrap ID UNI11809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143765721..143767927 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es