Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11843A10
Clone ID IST11843A10
Vector VICTR76
Project tigm

Sequence tag IST11843A10HMF1
Sequence
GCCCTGACTGTCCTGGAACTCACTTTGCAGACCAGGCTGA
Sequence Type genomic DNA
Unitrap ID UNI32073

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 116370445..116370483 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022112 (Gpc5) NM_175500 glypican 5 Gene [Source:MGI Symbol;Acc:MGI:1194894]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90041440..90041478 39
NO GENE  

 
Come back to gene ENSMUSG00000022112


For any suggestions or comments, please send an email to unitrap@crg.es