Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10024C10
Clone ID IST10024C10
Vector VICTR75
Project tigm

Sequence tag IST10024C10BBR1
Sequence
GAAGAAGGAACGTGTAAATTGATACCGCCATCATTGTGTCCCTTACATTGTCCCTCCCCTTTCCAGTTAGTATTCACATT
ATCGTTTCAATGACCCTTGACATCTTCTGTCTACAATCACTCCCCCCACCTCACCGACCATGTTATAGATAGGAACCGAC
AGAGGTTAACAAAAGGGCTTTCAAACTCCGATGTGCTAAATCGATTTCTATTTGGATGGTGTCACACGTCAGATGGCCTT
AGATCC
Sequence Type genomic DNA
Unitrap ID UNI10719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28517046..28517290 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]


Sequence tag IST10024C10BBF2
Sequence
GACCCTATCTCAAAAACAAACAAACAAAAAAGGGTGGTATTTCAAATTATAGTTTCAGTCCAACACTGAAGGAAGTCAGA
GCAGGCACTTGAAGCTAGAATCTGAAGTTTGACTGCTTGCTCTTCTGTGCAGTAATTGCCTCCAGGGAACTCACACACAC
AAGAGTGCAGCAGGAACCATGAAGCCCAGAAATACCCAACTAGAGATGGTGCAGTCCATTGACCTTCTATGTCATTTAGT
AAACAAAACAAAGCCCCACAGAACAATCTGGTAAAGTCCACCCAGACTCCTTTTCCAGGTGATTTCTAAGCCATGGCAAG
TTAGACAGTATATTTGAGAAGCATCTTTTGGAAATGAAGTAACACTACATATGAATTGTTCTTATCCACTTACTTACCTG
ATGTACTTACTTGAGTTGCTTCTGTTTTAACTCTGATTAACAATGCTGCTACCAACACAAGTGTCAATTCTTAGTATACA
CGCAGGAGCGACGCTGCTAGATCATGCAAGTCTAAAGTTTCATTTTCTTTTCTTTCTGTCTTTCAAGACAGGGTTTTCCC
TGTGTACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91545341..91545907 564
 
EST/CDNA Est Name
  AW414112.1 - BI555538.1 - BM943607.1 - BU517654.1 - BI733698.1 - BU705647.1 - CD348214.1 - CO433379.1 - BI685251.1 - BF137649.1 - BY750049.1 - BY742824.1 - BI684812.1 - BY728769.1 - CJ138685.1 - CF898737.1 - AI574339.1 - CN682353.1 - AI315876.1 - BY014898

 
Come back to gene AW414112.1 - BI555538.1 - BM943607.1 - BU517654.1 - BI733698.1 - BU705647.1 - CD348214.1 - CO433379.1 - BI685251.1 - BF137649.1 - BY750049.1 - BY742824.1 - BI684812.1 - BY728769.1 - CJ138685.1 - CF898737.1 - AI574339.1 - CN682353.1 - AI315876.1 - BY014898


For any suggestions or comments, please send an email to unitrap@crg.es