Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10376H11
Clone ID IST10376H11
Vector VICTR76
Project tigm

Sequence tag IST10376H11HMF1
Sequence
CTGACGACCTCTGTCTAGCTTCCACAGGTCTGCATACACGCCACACACAAGGAATGTCCCCCACTAACACCCAGCTTGTT
TTATTTCTTTTGCCAGCATCCACTCCTGCTCCCTTATCCTGGTCTGTGAGGTTCCTGTCTTTCTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI25402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57015415..57015562 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es