Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M053A02
Clone ID M053A02
Vector U3betageo
Project ggtc

Sequence tag M053A02
Sequence
TGNNNNGTGGNNNNNNTTGNNGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCGNNGGGTTNNNCNNNNNGTTTTGNNGTNNNTTNNNNNNNGNNTGGTGTTGGTNNNNNNNTATTTNNNNGGNNNNNN
TGNNNTTTTTTGTGNNNNNTTTTTTCTGCGCTTNNGTTTGTGTTGTTNGTTGGGGNNGNNNTGNNNNTTGGGTGTGGCGT
NNGTTGTNNNTTTCNNNNNTTATTCNNTCTGGGTGTTNNNGTTTAGTTNNNNTTTGNNGCCTNNNNNTGTTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTCCTTGGTNNNNTGCNNNTTGGNNTGGGNNNNTT
TTGAGTTTNNNNTTNNNTGGGTTNNNNNNNGAGGNNNTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNGGTGGNN
NNNGGGGGGGNGTTTTNNNNNNNNNNTTTTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGNCGGCCNGGNNNCNNNNGTGCCAAGTCCCCCGCCNNTGGGTCAANNNAAGGTCTCNNNAAAGGCCTCCCTCAGCTCAC
AGGCTGATCTCCAGAAGAAGAAGAGGGGGGGGGCAGCTCCTCCTCCACCACAGCAGCCACCACCAAGTCCTGTGGTCCCC
AACCGCAAGGAAGATAAGGAAGAGAACAGGAAGAGCACAGTGGNNCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCNNNNNNGCAT
Sequence Type mRNA
Unitrap ID UNI273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12209617..12209757 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]

 
Come back to gene ENSMUSG00000020173


For any suggestions or comments, please send an email to unitrap@crg.es