Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M041F05
Clone ID M041F05
Vector U3betageo
Project ggtc

Sequence tag M041F05
Sequence
CGGNNGCGGGGAGCTGGGNNNNGCCACACCATAAACCTTGGTGTAGATCACTTCCTTTTCTGTGGATTGAATCCAGTGAG
CACAATGAGTACAAGAAATCCCCAAGGAAAGCGGCGTGGTGGAACTGTGAATTCTAGACAAACCCAGAAGCGAACTCGGG
AAACAACTTCGACCCCTGAGGTTTCCTTGGAAACAGAACCCATAG
Sequence Type mRNA
Unitrap ID UNI11812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34685259..34689535 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029110 (Rnf4) NP_035408 ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]

 
Come back to gene ENSMUSG00000029110


For any suggestions or comments, please send an email to unitrap@crg.es