Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15110A11
Clone ID IST15110A11
Vector VICTR80
Project tigm

Sequence tag IST15110A11HMF2
Sequence
GTCNCAAGGCACAGTGGCCGAGTGGCAGCTGGCGTGTAAGATCCAAGGCCCGTGTGTGCCACCTGCTCTTGCCTGCCTTT
CACGAAGCCACGGACCCCTCGGGCCTCTGGCTCCCCAACGGTCTTGTATACAGAGGAGAGCAGGCAGCCAATCCTTGGCA
AATTATTCATGTCCTTCCCCATAGCTACACAAGTCCCTTAACGTGAGGTAACAGAAAACCTAGATTTTTCTAAGAACGAT
CATTTTTTATTTCACTTAAAAATATCCGTGAAATATATATTACATAAATATATCATTTTAACTGCTTTCAGTGTGTAGCA
TTAAATATGTCTGCGTTGTGTNNAGACCTTCACCTACATTTCCNNGANCTTCTTTATTGTCCCCAACTGAAACACTCACT
ACCCATTAAACATATCTCTCNNTCCCAGCTCTTGATGANCCCCCNCCCCAAATTCCTGTCTCTAAACTTNGN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121213758..121214226 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST15110A11HMR1
Sequence
CTATATACTTCTGCACACAGTGAAAGGATTTGAGTTAATTTATTTGAGACACTGATTGTCTCTTGCTTTGTAGACTANGT
TGGCTCACCCACCTCTTCCTCCTGAGTATGGGATCAAACGCCTATGCTATACCACACTCAGCCAGGATATAAAATGTCCT
GGGAAGCTTTTGTANCTCCACCACCCAATGTTGTANAGATTATCTANTCCTGTCCTGGGGTTTCCACCCTGCCTTTGGCT
ATTTAGTTCCTGGATAAAAGACACACTCAACCCTTATATTTACAATAAGCCTTAATCANCACAAGAACTGGGCACGTATA
CCCTCTATGCCACTAGAGTCTAATCCGTATTGGTGTTGATAACCCCGAGTTATTACTTACTATGTTTCATCTCCAATT
Sequence Type genomic DNA
Unitrap ID UNI34638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20375798..20376195 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022822 (Abcc5) NM_176839 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Gene [Source:MGI (curated);Acc:Abcc5-001]

 
Come back to gene ENSMUSG00000022822


For any suggestions or comments, please send an email to unitrap@crg.es