Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14700E8
Clone ID IST14700E8
Vector VICTR76
Project tigm

Sequence tag IST14700E8HMR1
Sequence
ACAGAAGTGCATAAAAAGAAAACACCCATACACATAAAAAATAAATAAATTTTTAAAAGCAATTTTAAGTGTTATGGGAA
CTCAGTATANACATTAAACATATGCTAGCTTGTTTTTTCAAACAGATATGGGCCTTACCTAGCGGCAGGTGTGCAGTAAG
CTTGTCTGCCGATGTTCCTCCCTGCCTCCCTCCCTCTGTGTCTTTGGACAGTGCTTTCTCCCTGGGGCTGTGAATATTTT
CAGGGTTTTACCAGCTGTATTTGTGCCTCTCACGCTGACTCTGCCTCCTTTCCAAGAAATGCTGTTTCTCCATCAGAGCC
TCTANATGTCCCCTGCAGCTCTCCCACTTGCTTANGATTTGACAAGATTN
Sequence Type genomic DNA
Unitrap ID UNI32478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8758464..8758832 363
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]


Sequence tag IST14700E8BBF1
Sequence
CTGTGTATCATGTGTGTGCCTGGTACCTTCAGAGGGCAGAAGAGGGCATTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8758829..8758883 55
NO GENE  


Sequence tag IST14700E8HMF1
Sequence
CTGTGTATCATGTGTGTGCCTGGTACCTTCAGAGGGCAGAAGAGGGCATTGGATCCCCTCGGACTACAGTTACAAATTGT
TATGAGCAGCTCTATGGGTGTAAGAAACAGAAGCAGAGTTCTCTGGAGGAGCAGCCAGTATCCTTCACCACTGAACCATC
TCTCCACACATACACACACACAAACACACCCCCACACCCACAGTAGATTTTGAGGTACTGGGGCATCAACCCAAGGTGTN
NNNNNCCACATTAAGCATGTGATCTGCCAGTGAACTGCACCCTTGGCCCAAGCTTGCANAATTTAGAGAAATGTTATCAC
NNNNCNTACTTGCTCCCCGTTGGGACCACATTAATGAAGCTGTCAAGAAACACCTGCTGCTACCCANANCTNACACATCC
CCACACAAAGGAACCATCGTGCTCCTTCATGGCACACTGNNNANCNAGANGTGAACNNAAGGATCCCACNNTANCCTGGT
CCNGTGTNCACTNATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046634


For any suggestions or comments, please send an email to unitrap@crg.es