Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10726D3
Clone ID IST10726D3
Vector VICTR76
Project tigm

Sequence tag IST10726D3HMR1
Sequence
TCTGCTTCTCCGATGTTTGAATGCGATAGGACCAAACCTCCTCTCTGTGTTTTATATCCGTTCTGGGTCTCAGTGACTAA
CGTTGAACTTTGGCTCCTGTTACTTGCCTGCGTGGAGAGTTAAGCTGGAGCTCTGCTTTGAACGATAAATAAAAGCTTAN
CCTCGACGAGACATAAATGGATCTAAAGACAGCGGTGTTCAACGCAGCGCGCGATGGCAAACTCCGGCTCCTCACCAAGT
TGCTGGCAAGCAAATCGAAAGCGGAGGTTTCCTCCTTAATCTNNNANAAAACAAATGGGGCCACCCCACTCTTGATGGCT
GCTANGTATGGACACCTCGACATGGTANAATTCCTTCTANANCANTGCANTGCTTCCATANAANTCNNGNGCNCNGNTN
Sequence Type genomic DNA
Unitrap ID UNI12170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46684090..46684475 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033319 (Fem1c) NM_173423 fem-1 homolog c (C.elegans) Gene [Source:MGI Symbol;Acc:MGI:2444737]


Sequence tag IST10726D3HMF1
Sequence
CAGAGCACCGAACTAGAGAATTAAAAAATATATAATTTTTTTAATAAAAGCAGTTTTAGGATTTTTGCATACAATGTAAA
GGTAAAAACACGATTTGGGCTTCCCTATTTTCTAATCTTGGGGGTGGGGGGAGAAAAGGAAAAAATGCCGTACTCGGAAC
GATCCTTCCCCCTTCCTCCAAAAGACGTGCGAAAGCAAAATACAAAAGGGTTCACACGGAGACCATACATAATGTTTCNA
CGGGAGGCAGTTCCTCCCAATGTGCGGAAAATGAAACACTACAGGCAATTGGTTTCCTCGTGTCCGGCTCTANCCNGCCC
ANCTTTGTTCTGGTTTTGCCTTGTACACGCCCAGTAGCGAGTAACCGAAAGGGGCAGGAGCCGCGGCGGGTTCCGAAAGG
TTTCTTCCTTGCATCTGCAGCGAACTCGCCNAGGGCGCGAGGCTGGGNNCCTNATGGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46684472..46684932 441
 
EST/CDNA Est Name
  BF465068.1 - AW491141.1 - AI505501.1 - BY131202.1 - BY305423.1 - BB852996.1 - BY331709.1 - BY037202.1 - BB611658.1 - CJ075143.1

 
Come back to gene BF465068.1 - AW491141.1 - AI505501.1 - BY131202.1 - BY305423.1 - BB852996.1 - BY331709.1 - BY037202.1 - BB611658.1 - CJ075143.1


For any suggestions or comments, please send an email to unitrap@crg.es