Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14996E6
Clone ID IST14996E6
Vector VICTR78
Project tigm

Sequence tag IST14996E6BBF1
Sequence
CTCTGCTTTAGGAAAATCACGTCATCTGACCATCCATCAGACAGTACCGAGAGACACCTGGTAGCCATTCGCAGCCATGT
AACTTAATACAAGATATTAAAGTGGGAGGCGACCAGGAATGGAAATGTAGTTCACATTTCGCTGAATGGAACAGAATGGA
ATTGGCTCATTTATGTTAGGACAGGTACGGTTAACCAAGTGGTATCAGGTCTCAGGCATTTTAATGAGTCCCGAAATGAA
CTTCCCCACAACTGCTGTGGAACACAGCGAGCANGCGCCCTACGGTGGAATGGGGATCGCCCTGTCTTCTGACCGCTCCA
CTCCCANANTAAGTANTTGGTAANTGAATTANCNNANCTGGCNNTNNCAACATTCTN
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771663..118772038 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]


Sequence tag IST14996E6HMF1
Sequence
CTCTGCTTTAGGAAAATCACGTCATCTGACCATCCATCAGACAGTACCGAGAGACACCTGGTAGCCATTCGCAGCCATGT
AACTTAATACAAGATATTAAAGTGGGAGGCGACCAGGAATGGAAATGTAGTTCACATTTCGCTGAATGGAACAGAATGGA
ATTGGCTCATTTATGTTAGGACAGGTACGGTTC
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771663..118771854 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]


Sequence tag IST14996E6HMR1
Sequence
GAGGAAGGGTTGCATGTTCAGCGTCNNNNTCAAGCCTGTGGTGCTTCCGACCCACAGAGAAGCANACGCTCTGGGTCACT
CCTGATTGGTTCTGCGTGCCCAGCAGGGGTGGGGCTGCCTAATACAAGGCCGGAAATGGAAATAACAGTCCCGGTGAGTC
CTCAGCTGTGATGCACCTANCTTTATGTGACCCACGCTTTGAAAGGCCGANAACACANCTTCTGGGTGTCAATGACCCAC
CATTTAAAGACNGCANNNAGCTCCTGGAGGTGTNNGNGNNCNTNTCCTNCTNAANANNGNNNANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es