Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14883F1
Clone ID IST14883F1
Vector VICTR76
Project tigm

Sequence tag IST14883F1HMR1
Sequence
CAACAACANAAACTATTGAAAGATCTGGATTGAGTCGCATGTAGTTCTAGACATTGTAAAGAAGTCATTTCTCCTTTTCA
GACCTATTTACTTATGTTAAGGTAGGGAATAGGGTANACTGGCATGTAACTTACCTTGCCAN
Sequence Type genomic DNA
Unitrap ID UNI789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78324841..78324981 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051232 (Tmem199) NM_199199 transmembrane protein 199 Gene [Source:MGI (curated);Acc:Tmem199-001]


Sequence tag IST14883F1BBF1
Sequence
GTTGTTACCGTTTCCCTACCCTCACCCCTAAACTGGGGCTTGCACCTTTACCTTTGAGATGGAAGGAAAAAAAATCACTT
TTTCCAAACACGATATGCTCACTATTGATATATGGCCCTCAAATGGAGAAACTCAACCTGTCANATAGTACTGGGCTACA
ATCTCGACTTCCTAAAAAAATTCNCATGGACTTAGGTGGCACTAANNGANGACTCAACAAAATCTGANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78324978..78325204 217
 
EST/CDNA Est Name
  CF579672.1 - BQ746033.1 - BQ833494.1 - BY124284.1 - BU560546.1 - AA537914.1 - R74820.1

 
Come back to gene CF579672.1 - BQ746033.1 - BQ833494.1 - BY124284.1 - BU560546.1 - AA537914.1 - R74820.1


For any suggestions or comments, please send an email to unitrap@crg.es