Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0814
Clone ID CG0814
Vector pGT0lxrT2
Project sanger

Sequence tag CG0814
Sequence
CTTTTCTTTTTGGACTGGATCAAGCAACTATGGGCCATGGAAATGAATTCTTCCAGTACACAGCCCCAAAGCAACGTAAG
AAAGGCCAGGGAACAGCAGCAGGAAATCAGACAGCACCAAAGCCAGCCCCAGCTACCACAGGCACGTCCTCAGTGCTGTT
TGCCACTGCAGTGCATGCATACCGCTACATAAATGGTCAATATGCAAAGCAGGGCAAATTTGGAGCGGCTGTCCTGGGGA
ACCACACAAGCAGAGAG
Sequence Type mRNA
Unitrap ID UNI1680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62007048..62013568 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066151 (Fkbp15) FK506 binding protein 15 Gene [Source:MGI (curated);Acc:Fkbp15-003]

 
Come back to gene ENSMUSG00000066151


For any suggestions or comments, please send an email to unitrap@crg.es