Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14907H10
Clone ID IST14907H10
Vector VICTR76
Project tigm

Sequence tag IST14907H10HMR1
Sequence
NAGGCTGGCCTCGAACTCANAAATCCGCCTGCCTCTGTCTCCCAAGTGCTGGGATTAAAGTCNTGCGCCGCCGCCACCAC
CACCACCTGGCTGACTTTCACAAGTTTTAAGACTAATTTTTAAAATCCTANATACAGTTGATATTCACACATGCAGGAAT
TCATTACGGTAGTTACTTCCCANCTACCTGGACTTTACCTATTCATTTTTATATCTATACTGGCAGAGTTACATTGGCCA
G
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385877..127386115 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14907H10BBF1
Sequence
GAAGCAGGCCTGTGGGATAGGTCTGTTATTGTCCCCATTCTATGTATAAGTAAACTGAGGTTAAACAACCAGTCTGCTTT
ACCTGTTCAAAGAATCTCCGATAACTTAATATGATAATCAGTCAAATAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30981025..30981158 134
NO GENE  

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es