Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14912D9
Clone ID IST14912D9
Vector VICTR76
Project tigm

Sequence tag IST14912D9HMF2
Sequence
NAATGACCCCGCTTTGTAGCTCAATCTGGTCTGGAATCACTATGTAGCCCAGGCTAGCCAGGAACTCCTGCCCCAGTCTC
TGAGTGTTGAGATTACGGGTCTAAGTCATTTATAAACACCAAAACAGAGGCTAGGCCTGTGTGTGTGTCCAGCACCTGAC
ATAAACCTAGAGCATGCACAAGCTCCGTAATATCTGTGATTTGCTTCGGTGGGGGTGGAGGGGTTTGTTGAGACAGGGTT
AACG
Sequence Type genomic DNA
Unitrap ID UNI32500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70782820..70783061 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040667 (Nup88) NM_001083331 nucleoporin 88 Gene [Source:MGI (curated);Acc:Nup88-001]

 
Come back to gene ENSMUSG00000040667


For any suggestions or comments, please send an email to unitrap@crg.es