Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13209H10
Clone ID IST13209H10
Vector VICTR74
Project tigm

Sequence tag IST13209H10HMR1
Sequence
GTAGCCNTCCCCCATTTTTCTGAATTTATTTATTTATTATATGTAGGTACACTGTAGCTGTTTTCAGACACACCAGAAGA
GGGCATCAGATCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGAACCTTCAGAAGAACAG
TCAGTGCTCCTAACTGCTGAGCCATCTCTCCAGCCCCCATTTACATTTCAAATGCTATCCTGAAAGTCCCCTATACCCTC
CCCCTGCCCACTGTATCTTTATATAGTCTTGTGTATTTGTAGCCATCCCCCATTTTTCTGAATTTCCTCTTAAAAGGACA
TTAGTTAGATTATACTAGGAGCCATCCATATGATGCTGAAATTTTTTATGACTGTGAGTCAGGTGAAATGGCCCAAGCCT
ATGATCCNNAATGAGGATGCTGANGCAGAGGCAGGAGGATTGCAAGGTCAANGCTGGCCTGGGCNNCATAGTTCCAGANN
NTCTTTTTTTTGTTTTGNTTTGNTTTGTTTNNGTNGNTTNGNTN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70337612..70338130 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST13209H10HMF1
Sequence
CTACAAATACACAAATAAAAGACGATATAAAGATACAGTGGGCAGGGGGTATAGGGGACTTTCAGGATAGCATTTGAAAT
GTAAATGTAAAAAGAAATGTAAATGAAAAAAATACCTAATTTAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70338127..70338267 139
 
EST/CDNA Est Name
  CA883725.1


Sequence tag IST13209H10BBF1
Sequence
CCAGAGGCCTTGAGTTCAATTCCCAGCTACCACATGGTGACTCACAACCATCTGTACTGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95674103..95674168 66
NO GENE  

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es