Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241D2
Clone ID IST14241D2
Vector VICTR74
Project tigm

Sequence tag IST14241D2HMR1
Sequence
TTAAAGTATAACTATGGAAGAGGAGAAGATTGAGGTAGAAGATGAAGTAGTTTCAGTCTGTTGAGTGTTTCACACTTCAC
CCCTCTTCAGTTTACATTTTTTATTGATAAGCCTTTGACTATTTAGAATAGCTTTGCAGGTTTATCTGTTTGGGAGTTGA
TAGCAGAAGATGAATCTTCTTTATGTCTGTCTTTTACACGCTTAGGTGTTTTTGTCTCCTTTAAAGGGAAAAAATTAACT
CANAATATACGTGTGANAAAACCANCAAATGGTCNGGAAAGAAGAGTGGGGTGGGGACNGAGAGGGACNAGCANCNNTCC
NGGNCN
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17980580..17980902 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14241D2BBF1
Sequence
GAATAACTTGAAGTTTGAAAGCCTTCCCACACATTTGGACTCCATTCCAAAGCATAGCTCTACTCTCTGCTTTTCAAAGA
TATTCTCCAGAGATGTGAACACTTGCAGGCTGCCCTGGGCTTCATCGCCTTGGTTTTGTTTTTGTTTTTGTTTTTGATCG
GATTCTTGTGAGTTTATATCATATTTTACCTTCTTCCTTTGGCTGTCNCCNTANNCGTATTTGTTGTGGATGGGCCTGGC
TGNTCNTGTGAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96041390..96041643 242
NO GENE  


Sequence tag IST14241D2HMF2
Sequence
TAAATAGTTATACTTCTCATAATTATACTTTAAATGACTTCTCTGACATAAAATTTCTCCCCGAGCCTTAAAATGAGTGT
TTTCCATGAGGAACTGCAGCTTTAGAGAGAAGACCTGTAAAATCAAAGTGTTCAGACGCAAACTACTTTTCAAAAGCAAA
ATCACACCGTCCACTACCCTTAACTGACTCTTACGGGGTCTTTTCAACATGCTGTTTACCCATCAGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17980352..17980582 231
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es