Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566A3
Clone ID IST14566A3
Vector VICTR74
Project tigm

Sequence tag IST14566A3HMR1
Sequence
TATCCATAGAGCATGCGCATTTGCTCTTGATNAGTCATCGGCATTCTCATGTTTCTGCTGGGTCTCCTTTGTCTTCTGCA
TTTACAGATCATCCACATGGTCTTCGATTTGCTCCCTCCAGCAATTGAAAGTTATGTAATTGTTTTTATTTTATTACCAA
TTAGAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55002770..55002938 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]


Sequence tag IST14566A3HMF1
Sequence
GATATGAGGAAACTGGATCACCCCTCCTTTGGAAAATGTCCCTGGGTAGATGGAAAACTAAATCTTTAATTGTGTTTTGC
TTACAGAAGGCATGCACATAGGCAAATGACACAGAGTTTGAGTGTGATGACATGATCGCAAAGATACTAAGCAAAATAAA
ATAAGGAGAGAGCTCCTCCTTAGTATTAGTCATGGCTAAATTCAAGACAGAAGCTCTCTGGATGGCAAAGACAAACACTT
GATAACATAAGAGAACAATCCACAGTGAAGATTTATAATGAATATCTGTGTCCACTTAACAGCACCAAGAGACACCAAAA
CAATGGCAACAGACAAGACAGAGGCCCGAGCATTGAATAGACTAAATGGAGACAGACAACTAAGGATATAATTAATATCA
TTAACAAAATTGAGTTAAGAGATACATTTTACATTTTAGANCCCAGAAATAGAAATCGTACTTTTGTGTTTTTCGAGTAT
CTGTGGAATATTTACAGANGTTTTCAAGTGCCCACCGATGTTTCCCAAGGTCCTNNNTGCCNNANTTGAGAGANAATGAA
NNNCAAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55002206..55002773 544
NO GENE  


Sequence tag IST14566A3BBF1
Sequence
GATATGAGGAAACTGGATCACCCCTCCTTTGGAAAATGTCCCTGGGTAGATGGAAAACTAAATCTTTAATTGTGTTTTGC
TTACAGAAGGCATGCACATAGGCAAATGACACAGAGTTTGAGTGTGATGACATGATCGCAAAGATACTAAGCAAAATAAA
ATAAGGAGAGAGCTCCTCCTTAGTATTAGTCATGGCTAAATTCAAGACAGAAGCTCTCTGGATGGCAAAGACAAACACTT
GATAACATAAGAGAACAATCCACAGTGAAGATTTATAATGAATATCTGTGTCCACTTAACAGCACCAAGAGACACCAAAA
CAATGGCAACAGACAAGACAGAGGCCCGAGCATTGAATAGACTAANTGGAGACAGACAACTAAGGATATAATTNATATCA
TTAACAAAATTGAGTTNAGAGATACATTTNACATTTTANATCCCAGANATANNNNTCGTACTTTNGNGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55002310..55002773 444
NO GENE  

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es