Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14637D1
Clone ID IST14637D1
Vector VICTR74
Project tigm

Sequence tag IST14637D1HMR1
Sequence
TAGCTAGAGATTTTNAGCCTTTTAATATCTCACACATTTTCTTTTAAATTGTTTTTGTTTTATATTCGTTCATGGTCTTG
GTTTGGTTTTGGGGGGCTNNNANCCCN
Sequence Type genomic DNA
Unitrap ID UNI16036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95030759..95030856 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053192 (Mllt11) NM_019914 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 Gene [Source:MGI (curated);Acc:Mllt11-001]


Sequence tag IST14637D1HMF1
Sequence
GCTATACCATTGACCTATCGACATGTACAGAGAGACTCAAATTTGTCCCAGAAAACAGACATAAAGGCATATGTGGCATT
AAAATAAAAAAGACCGGCTGCTCTTCAGCTATCGTCCCCTTTCTTTCCCTAAATGCTCTTCACCCATCATTTTATCTATT
TTTGCTTATCCTAAGGGCTCTGGATGGTGAAAATTGACATATTTGCTCAGTAAATGCCACCCAGTTATTTTATGCANAGT
ANCTTNTNNNTTTTCATTGTCTATTCTTANAGATAAAATGATTANTAGATACACACNTTTANNAGATACNCTTTCTTTAA
ACTACCTGGACACNCCCAANTACCCTTTGTCCAGATNC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95030853..95031208 328
 
EST/CDNA Est Name
  BG148711.1 - DV068431.1 - AA756294.1 - BE653935.1 - CD770137.1 - BU562722.1 - BQ832731.1 - BU604918.1 - AI115422.1 - CJ146162.1 - BU847786.1 - BU562485.1 - CJ144700.1 - CB231497.1 - AI930446.1 - AI116536.1 - CJ144680.1 - CB274156.1 - CJ144210.1 - CJ144704


Sequence tag IST14637D1BBF1
Sequence
GCTATACCATTGACCTATCGACATGTACAGAGAGACTCAAATTTGTCCCAGAAAACAGACATAAAGGCATATGTGGCATT
AAAATAAAAAAGACCGGCTGCTCTTCAGCTATCGTCCCCTTTCTTTCCCTAAATGCTCTTCACCCATCATTTTATCTATT
TTTGCTTATCCTAAGGGCTCTGGATGGTGAAAATTGACATATTTGCTCAGTAAATGCCACCCAGTTATTTTATGCANAGT
AACTTCTAAATTTTCATTGTCTATTCTTAGAGATAAAATGATTAGTAGATACACACATTTAAAAGATACACTTTCTTTAA
ACTACCTGGACACACCCAAATACCCTTTGTCCAGATCCCCCCAAGAGCATTCAAGGCCTAATCCACAGGGCCTTGCTGTG
TCATGCTGCCACCATGCAGTCTAAGGANNGATGGTGGTGGATGAAAATGGAGGCTTCCTGGTATTTCTNNTGTTGCTCNA
NGANTTTNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95030853..95031342 472
 
EST/CDNA Est Name
  CB057719.1 - CX239686.1 - BU921887.1 - BU504002.1 - BB644564.1 - BG298544.1 - BU923878.1 - BU924194.1 - CD772579.1 - BU503570.1 - CD364089.1 - BU919398.1 - BU503986.1 - BQ892102.1 - CO427263.1 - CV562767.1 - BU920164.1 - BG801580.1 - DN175384.1 - CJ142941

 
Come back to gene CB057719.1 - CX239686.1 - BU921887.1 - BU504002.1 - BB644564.1 - BG298544.1 - BU923878.1 - BU924194.1 - CD772579.1 - BU503570.1 - CD364089.1 - BU919398.1 - BU503986.1 - BQ892102.1 - CO427263.1 - CV562767.1 - BU920164.1 - BG801580.1 - DN175384.1 - CJ142941


For any suggestions or comments, please send an email to unitrap@crg.es